itm2cb

Ensembl ID:
ENSDARG00000039650
ZFIN ID:
ZDB-GENE-030131-7806
Description:
integral membrane protein 2Cb [Source:RefSeq peptide;Acc:NP_956274]
Human Orthologue:
ITM2C
Human Description:
integral membrane protein 2C [Source:HGNC Symbol;Acc:6175]
Mouse Orthologue:
Itm2c
Mouse Description:
integral membrane protein 2C Gene [Source:MGI Symbol;Acc:MGI:1927594]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17500 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057957 Essential Splice Site 142 260 4 6
ENSDART00000128103 Essential Splice Site 227 345 5 7
Genomic Location:
Chromosome 2 (position 48405826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCRATTTTGAGTCGTTATTAACGGAGGTGTTCTGCTTTGTCATCCACAC[A/T]GGGACTCACAGCTTACTACGACATTGCRTTGGATAAGTGCTACGTGATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3db3vwm8