mtif3

Ensembl ID:
ENSDARG00000039649
ZFIN ID:
ZDB-GENE-060228-1
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BEV1]
Human Orthologue:
MTIF3
Human Description:
mitochondrial translational initiation factor 3 [Source:HGNC Symbol;Acc:29788]
Mouse Orthologue:
Mtif3
Mouse Description:
mitochondrial translational initiation factor 3 Gene [Source:MGI Symbol;Acc:MGI:1923616]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8213 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057956 Nonsense 21 236 1 3
ENSDART00000144879 Nonsense 65 280 2 4
Genomic Location:
Chromosome 5 (position 70994587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTCCACAGACACCGATGGTGGGGATCCTGCCATTCAGACAGATTCC[C/T]AGAAGAAGAAKAATAAAAAGCTGGACCCGAGAGCACGGGTCACTATTAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ci0nwq1i