si:dkey-179o14.3

Ensembl ID:
ENSDARG00000039616
ZFIN ID:
ZDB-GENE-090313-204
Description:
Novel protein similar to H.sapiens CENPK, centromere protein K (CENPK) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
CENPK
Human Description:
centromere protein K [Source:HGNC Symbol;Acc:29479]
Mouse Orthologue:
Cenpk
Mouse Description:
centromere protein K Gene [Source:MGI Symbol;Acc:MGI:1926210]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25607 Nonsense Mutation detected in F1 DNA During 2017
sa32700 Nonsense Mutation detected in F1 DNA During 2017
sa19520 Nonsense Available for shipment Available now
sa7369 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Nonsense 10 306 2 11
ENSDART00000139828   None 169 1 9
ENSDART00000146567   None 275 1 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30970052)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30783512
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCGTATTACATCAGCATTACGTCAATACGTCGCGTTGGCTGGCGGTA[T/G]TTTTGTTTTGAATGTACGCTGTTTGATCTGAAGCTGTGGTCAAGCATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Nonsense 28 306 2 11
ENSDART00000139828   None 169 1 9
ENSDART00000146567   None 275 1 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30969999)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30783459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTGAATGTACGCTGTTTGATCTGAAGCTGTGGTCAAGCATTAGCT[T/G]AAATATAAGTATGGTGAGTACTAGTACGACTAGCTAAACGCTGTTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Nonsense 63 306 3 11
ENSDART00000139828 Nonsense 32 169 2 9
ENSDART00000146567 Nonsense 32 275 2 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30969627)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30783087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGACTTCAGAGGACACAGGCTGTATGAGTGCTGCAAAAGCTGTGTTGT[T/A]GGATGAGTGTGAGGAGCAGTTCGGGCTGCTACAGAAGGTAATTTGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Missense 221 306 9 11
ENSDART00000139828   None 169 9 9
ENSDART00000146567 Missense 190 275 8 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30963547)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30777007
KASP Assay ID:
554-4197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATATCATAGCAGCCTCATGGAAATGCTGAGYGACATGTTAGCTGAGCA[C/A]TTCCCACTTCCTGATCCTCAAGAAARCGGCAGTAAGAAAAAAAGAGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link