fgf8b

Ensembl ID:
ENSDARG00000039615
ZFIN ID:
ZDB-GENE-010122-1
Description:
Fibroblast growth factor 8b [Source:UniProtKB/Swiss-Prot;Acc:Q805B2]
Human Orthologue:
FGF8
Human Description:
fibroblast growth factor 8 (androgen-induced) [Source:HGNC Symbol;Acc:3686]
Mouse Orthologue:
Fgf8
Mouse Description:
fibroblast growth factor 8 Gene [Source:MGI Symbol;Acc:MGI:99604]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19522 Nonsense Mutation detected in F1 DNA During 2016
sa14664 Nonsense Available for shipment Available now
sa39633 Nonsense Mutation detected in F1 DNA During 2016
sa32701 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057885 Nonsense 100 212 4 5
Genomic Location:
Chromosome 1 (position 31095585)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGCAGCAAAACTTGTTGTGGAAACGGATACATTTGGAAGCCGGGTT[C/T]GAATCAGAGGGGCAAAAACAGGATACTATATTTGCATGAACAAGAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057885 Nonsense 109 212 4 5
Genomic Location:
Chromosome 1 (position 31095614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATACATTTGGAAGCCGGGTTCGAATCAGAGGGGCAAAAACAGGAYACTA[T/A]ATTTGCATGAACAAGAAAGGCAAGCTCATTGGACGGGTGAGTAAATKRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39633
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057885 Nonsense 151 212 5 5
Genomic Location:
Chromosome 1 (position 31096090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGGAAAATAACTACACAGCTTTGCAGAATGCCAAGTACAAAGGCTG[G/A]TACATGGCCTTTACACGCAAGGGTCGACCCAGGAAAGCCATGCAGACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057885 Nonsense 189 212 5 5
Genomic Location:
Chromosome 1 (position 31096202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGGCCCACTTCATGAAACGTCTTCCTCGAGGACACCTATTAACAGAA[C/T]AGAAGCCCTTTGATTTAATCCCATATCCCCTCAACAAGAGGACTAAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link