fgf8b

Ensembl ID:
ENSDARG00000039615
ZFIN ID:
ZDB-GENE-010122-1
Description:
Fibroblast growth factor 8b [Source:UniProtKB/Swiss-Prot;Acc:Q805B2]
Human Orthologue:
FGF8
Human Description:
fibroblast growth factor 8 (androgen-induced) [Source:HGNC Symbol;Acc:3686]
Mouse Orthologue:
Fgf8
Mouse Description:
fibroblast growth factor 8 Gene [Source:MGI Symbol;Acc:MGI:99604]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19522 Nonsense Mutation detected in F1 DNA During 2014
sa14664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057885 Nonsense 100 212 4 5
Genomic Location:
Chromosome 1 (position 31095585)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGCAGCAAAACTTGTTGTGGAAACGGATACATTTGGAAGCCGGGTT[C/T]GAATCAGAGGGGCAAAAACAGGATACTATATTTGCATGAACAAGAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057885 Nonsense 109 212 4 5
Genomic Location:
Chromosome 1 (position 31095614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATACATTTGGAAGCCGGGTTCGAATCAGAGGGGCAAAAACAGGAYACTA[T/A]ATTTGCATGAACAAGAAAGGCAAGCTCATTGGACGGGTGAGTAAATKRAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xb4r0h99