poll

Ensembl ID:
ENSDARG00000039613
ZFIN ID:
ZDB-GENE-040426-2712
Description:
DNA polymerase lambda [Source:RefSeq peptide;Acc:NP_998408]
Human Orthologue:
POLL
Human Description:
polymerase (DNA directed), lambda [Source:HGNC Symbol;Acc:9184]
Mouse Orthologue:
Poll
Mouse Description:
polymerase (DNA directed), lambda Gene [Source:MGI Symbol;Acc:MGI:1889000]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11644 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057880 Nonsense 271 566 5 9
ENSDART00000127666 Nonsense 323 618 5 9
Genomic Location (Zv9):
Chromosome 1 (position 31115329)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30928789
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCCAAAGCCTATACGCATACGGGTGATAAATGGAGAGCTCTGGGCTA[T/G]TCTAAAGCCATCAACGCCCTTAAGAGCTACCACAAGCCCATCACTTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link