mat1a

Ensembl ID:
ENSDARG00000039605
ZFIN ID:
ZDB-GENE-030131-6127
Description:
S-adenosylmethionine synthase isoform type-1 [Source:RefSeq peptide;Acc:NP_956165]
Human Orthologue:
MAT1A
Human Description:
methionine adenosyltransferase I, alpha [Source:HGNC Symbol;Acc:6903]
Mouse Orthologue:
Mat1a
Mouse Description:
methionine adenosyltransferase I, alpha Gene [Source:MGI Symbol;Acc:MGI:88017]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2678 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2678
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057869 Nonsense 260 390 7 9
Genomic Location:
Chromosome 13 (position 18680163)
KASP Assay ID:
554-2509.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTAAAATAATCTCTTTTTNCCAGGGAGATGCTGGTGTTACAGGAAGG[A/T]AGATTATTGTGGACACATATGGTGGATGGGGAGCTCATGGTGGTGGYGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l70k0y2y