ptk2bb

Ensembl ID:
ENSDARG00000039577
ZFIN ID:
ZDB-GENE-020507-1
Description:
protein-tyrosine kinase 2-beta [Source:RefSeq peptide;Acc:NP_997735]
Human Orthologue:
PTK2B
Human Description:
PTK2B protein tyrosine kinase 2 beta [Source:HGNC Symbol;Acc:9612]
Mouse Orthologue:
Ptk2b
Mouse Description:
PTK2 protein tyrosine kinase 2 beta Gene [Source:MGI Symbol;Acc:MGI:104908]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13195 Essential Splice Site Available for shipment Available now
sa8976 Nonsense Mutation detected in F1 DNA During 2017
sa10636 Nonsense Available for shipment Available now
sa37004 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13195
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057819 Essential Splice Site 392 1004 13 31
Genomic Location (Zv9):
Chromosome 20 (position 19918492)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19946749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCTCTTTYCTGTTGACAGGAAGAAGACAGACAGCTTCAGATATAGCAG[T/C]GAGTATCAGACCTTATTAGAACTTAGCTTGATATTTACTGAATTGTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057819 Nonsense 539 1004 18 31
Genomic Location (Zv9):
Chromosome 20 (position 19916726)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19944983
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAGCTCTGCAAAGCATTGGTTTACCTACAGGGAATGAACWTGGTTCAT[C/T]GGTGCGACACYCAATTCAGTATTCTTGAATGTTTTCTGTTCTTCATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057819 Nonsense 640 1004 21 31
Genomic Location (Zv9):
Chromosome 20 (position 19911225)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19939482
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATGTGATAAACCAACTGGAACAGGGCAACAGGCTGCCCAAACCTGAG[C/T]AGTGCCCTCCTGCCCTGTATTCKCTCATGACCCGCTGCTGGAGCTACGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057819 Essential Splice Site 854 1004 28 31
Genomic Location (Zv9):
Chromosome 20 (position 19904492)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 19932749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGAACTCCATCATCCTCCTTCAAAACCACCCAGAATAGCAGTGCAG[G/A]TTAGGACTCAATTTACCAACGCCTTTATGTACACTACAAATGTTTAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link