fstl1b

Ensembl ID:
ENSDARG00000039576
ZFIN ID:
ZDB-GENE-030131-3029
Description:
follistatin-like 1b [Source:RefSeq peptide;Acc:NP_001034710]
Human Orthologue:
FSTL1
Human Description:
follistatin-like 1 [Source:HGNC Symbol;Acc:3972]
Mouse Orthologue:
Fstl1
Mouse Description:
follistatin-like 1 Gene [Source:MGI Symbol;Acc:MGI:102793]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21439 Nonsense Mutation detected in F1 DNA During 2014
sa1267 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083326 Nonsense 56 309 4 11
ENSDART00000121456 Nonsense 57 310 4 11

The following transcripts of ENSDARG00000039576 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 9992835)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATGTGGCAGTGGTGATGTTTTCATTGTTGTGTTCTCCTGCAGCAATG[C/A]AAGACTCATAAGCGCTCGGTGTGTGGCAGTAATGGAAAGACATACCGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083326 Essential Splice Site 266 309 9 11
ENSDART00000121456 Essential Splice Site 267 310 9 11

The following transcripts of ENSDARG00000039576 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 9964902)
KASP Assay ID:
554-1182.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGTCTGCGCTTGTGGAAACTGGGTCTGCACCGCCATGACTTGTGATG[G/A]TGAGCTTTAATTTGCAMATCTGTTATCATCTTATTTTGATAAATGACAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3jxobwzv