fstl1b

Ensembl ID:
ENSDARG00000039576
ZFIN ID:
ZDB-GENE-030131-3029
Description:
follistatin-like 1b [Source:RefSeq peptide;Acc:NP_001034710]
Human Orthologue:
FSTL1
Human Description:
follistatin-like 1 [Source:HGNC Symbol;Acc:3972]
Mouse Orthologue:
Fstl1
Mouse Description:
follistatin-like 1 Gene [Source:MGI Symbol;Acc:MGI:102793]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34567 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21439 Nonsense Mutation detected in F1 DNA During 2016
sa1267 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083326 Essential Splice Site 19 309 2 11
ENSDART00000121456 Essential Splice Site 20 310 2 11

The following transcripts of ENSDARG00000039576 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 10063268)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9863819
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTTACCCGTGTTTTTCCTCCTGGCTGTAGTCTGCTGTCATGCCGAG[G/A]TAAGTTACACCAAACCCGCTTTTAATAAGGAGAAGAGCTCGTGTTTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083326 Nonsense 56 309 4 11
ENSDART00000121456 Nonsense 57 310 4 11

The following transcripts of ENSDARG00000039576 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 9992835)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9793386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATGTGGCAGTGGTGATGTTTTCATTGTTGTGTTCTCCTGCAGCAATG[C/A]AAGACTCATAAGCGCTCGGTGTGTGGCAGTAATGGAAAGACATACCGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083326 Essential Splice Site 266 309 9 11
ENSDART00000121456 Essential Splice Site 267 310 9 11

The following transcripts of ENSDARG00000039576 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 9964902)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 9765453
KASP Assay ID:
554-1182.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCGTCTGCGCTTGTGGAAACTGGGTCTGCACCGCCATGACTTGTGATG[G/A]TGAGCTTTAATTTGCAMATCTGTTATCATCTTATTTTGATAAATGACAGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link