loxl3b

Ensembl ID:
ENSDARG00000039563
ZFIN ID:
ZDB-GENE-030131-8210
Description:
LOXL3 protein [Source:RefSeq peptide;Acc:NP_001139156]
Human Orthologue:
LOXL3
Human Description:
lysyl oxidase-like 3 [Source:HGNC Symbol;Acc:13869]
Mouse Orthologue:
Loxl3
Mouse Description:
lysyl oxidase-like 3 Gene [Source:MGI Symbol;Acc:MGI:1337004]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036875 None None 306 None 5
ENSDART00000109245 Nonsense 28 141 2 5
ENSDART00000121453 Nonsense 155 268 3 6
ENSDART00000129314 Nonsense 694 807 12 15
Genomic Location:
Chromosome 13 (position 15354037)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCGAATGGCACTAAGGTTGCAGAAGGACACAAAGCCAGTTTCTGCCTA[G/T]AGGACACTGACTGTGATGAAGGTCAATCCCACTGATCCAGAAACGTCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lzfprzta