c8b

Ensembl ID:
ENSDARG00000039517
ZFIN ID:
ZDB-GENE-070912-163
Description:
Novel protein similar to vertebrate complement component 8, beta polypeptide (C8B) [Source:UniProtKB
Human Orthologue:
C8B
Human Description:
complement component 8, beta polypeptide [Source:HGNC Symbol;Acc:1353]
Mouse Orthologue:
C8b
Mouse Description:
complement component 8, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88236]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19652 Nonsense Mutation detected in F1 DNA During 2016
sa32824 Nonsense Mutation detected in F1 DNA During 2016
sa15704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 281 562 7 12
Genomic Location (Zv9):
Chromosome 2 (position 2524987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2392639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCGTGCTCACTCTGAGCTTGAGGTCGCTCGCTACGCTTTAAAACCA[C/T]AAAACCTGATGCTACACCCTGAGTTTGTGTCCCGACTGAACGCGCTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 307 562 7 12
Genomic Location (Zv9):
Chromosome 2 (position 2524909)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2392561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCCGACTGAACGCGCTGCCGCTGGAGTACTCATACGGAGAATACCGG[C/T]AGATCTACCAAGACTACGGCACACATTTCATCAAGGAGGCAACTCTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 365 562 8 12
Genomic Location (Zv9):
Chromosome 2 (position 2524248)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2391900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGTGTGCAGGTTGGGCTTAAGGTTGGAGTCCAGGYTAAAAAKATCTA[T/A]GTGGGACTTGGACTTTCAGGTGGAARCTGTGAAGGCCTGCTGAAAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link