c8b

Ensembl ID:
ENSDARG00000039517
ZFIN ID:
ZDB-GENE-070912-163
Description:
Novel protein similar to vertebrate complement component 8, beta polypeptide (C8B) [Source:UniProtKB
Human Orthologue:
C8B
Human Description:
complement component 8, beta polypeptide [Source:HGNC Symbol;Acc:1353]
Mouse Orthologue:
C8b
Mouse Description:
complement component 8, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88236]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19652 Nonsense Mutation detected in F1 DNA During 2014
sa15704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 281 562 7 12
Genomic Location:
Chromosome 2 (position 2524987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCGTGCTCACTCTGAGCTTGAGGTCGCTCGCTACGCTTTAAAACCA[C/T]AAAACCTGATGCTACACCCTGAGTTTGTGTCCCGACTGAACGCGCTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 365 562 8 12
Genomic Location:
Chromosome 2 (position 2524248)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTGTGTGCAGGTTGGGCTTAAGGTTGGAGTCCAGGYTAAAAAKATCTA[T/A]GTGGGACTTGGACTTTCAGGTGGAARCTGTGAAGGCCTGCTGAAAGAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/symsr340