atf4b1

Ensembl ID:
ENSDARG00000039515
ZFIN ID:
ZDB-GENE-040426-2340
Description:
Cyclic AMP-dependent transcription factor ATF-4 [Source:UniProtKB/Swiss-Prot;Acc:Q6NW59]
Human Orthologue:
ATF4
Human Description:
activating transcription factor 4 (tax-responsive enhancer element B67) [Source:HGNC Symbol;Acc:786]
Mouse Orthologue:
Atf4
Mouse Description:
activating transcription factor 4 Gene [Source:MGI Symbol;Acc:MGI:88096]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042970 Nonsense 230 339 3 3
Genomic Location:
Chromosome 6 (position 220315)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGCTCMGATAGYGACAGCGGGATCYCAGTCYCAGGATCTCCAGCTCAT[C/T]AATCAGATCTAGAACCCTCATCCAGAGCTAAACCATACTCCAGACCCGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2khs520a