LOC100333421

Ensembl ID:
ENSDARG00000039500
Human Orthologues:
LRFN1, LRFN2, LRFN4, LRFN5
Human Descriptions:
leucine rich repeat and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:29290]
leucine rich repeat and fibronectin type III domain containing 2 [Source:HGNC Symbol;Acc:21226]
leucine rich repeat and fibronectin type III domain containing 4 [Source:HGNC Symbol;Acc:28456]
leucine rich repeat and fibronectin type III domain containing 5 [Source:HGNC Symbol;Acc:20360]
Mouse Orthologues:
Lrfn1, Lrfn2, Lrfn4, Lrfn5
Mouse Descriptions:
leucine rich repeat and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:213
leucine rich repeat and fibronectin type III domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:191
leucine rich repeat and fibronectin type III domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:238
leucine rich repeat and fibronectin type III domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:214

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18342 Nonsense Available for shipment Available now
sa14275 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028944 Nonsense 246 639 1 2
Genomic Location:
Chromosome 18 (position 48266236)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGGATCACCGCTGACYGCACTKGTGCTCAGTTTCGGGGGGAATCCGT[T/A]GCATTGTAATTGCGAGTTGGTTTGGTTGAGACGTCTTACTCGTGAGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028944 Nonsense 432 639 1 2
Genomic Location:
Chromosome 18 (position 48266795)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGRGTCACGGTTTCAGAAATTACRCCCAGCTCTGCTATGATCCGCTG[G/A]CCTCMACAAAGCCAGATTCCTGGAGTGCGCATGTACCAGRTCCAGTACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tumuhr50