ccdc85a

Ensembl ID:
ENSDARG00000039497
ZFIN ID:
ZDB-GENE-080220-55
Description:
coiled-coil domain containing 85A [Source:RefSeq peptide;Acc:NP_001108385]
Human Orthologue:
CCDC85A
Human Description:
coiled-coil domain containing 85A [Source:HGNC Symbol;Acc:29400]
Mouse Orthologue:
Ccdc85a
Mouse Description:
coiled-coil domain containing 85A Gene [Source:MGI Symbol;Acc:MGI:2445069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1373 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057710 Nonsense 291 408 2 4
ENSDART00000146712 Nonsense 291 421 2 4
Genomic Location:
Chromosome 13 (position 27260310)
KASP Assay ID:
554-1285.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGCCGGTCCCGCTGTGGATCCTTCTCCAGTCCAGATCACAAGGGACTA[C/T]GAGGTCTTAGTCCAGAGAAACTTGCCAAAAGGGGCAGTCCAGAGCAATTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qruaipkd