naa20

Ensembl ID:
ENSDARG00000039493
ZFIN ID:
ZDB-GENE-050327-47
Description:
N-alpha-acetyltransferase 20, NatB catalytic subunit [Source:UniProtKB/Swiss-Prot;Acc:Q58ED9]
Human Orthologue:
NAA20
Human Description:
N(alpha)-acetyltransferase 20, NatB catalytic subunit [Source:HGNC Symbol;Acc:15908]
Mouse Orthologue:
Naa20
Mouse Description:
N(alpha)-acetyltransferase 20, NatB catalytic subunit Gene [Source:MGI Symbol;Acc:MGI:1915127]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37163 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057700 Essential Splice Site 151 178 5 6
Genomic Location (Zv9):
Chromosome 20 (position 49414947)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 49300383
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGAGTATTACTCTGCCAGTAACGGTGAACCTGATGAAGATGCTTATGG[T/G]GAGTTGTTGCAAAAAGTGGCATTTATAGTTTAACATAAACTTTCTATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link