C20orf26 (1 of 2)

Ensembl ID:
ENSDARG00000039491
Description:
chromosome 20 open reading frame 26 [Source:HGNC Symbol;Acc:15872]
Human Orthologue:
C20orf26
Human Description:
chromosome 20 open reading frame 26 [Source:HGNC Symbol;Acc:15872]
Mouse Orthologue:
4930529M08Rik
Mouse Description:
RIKEN cDNA 4930529M08 gene Gene [Source:MGI Symbol;Acc:MGI:1926024]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39308 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43536 Nonsense Mutation detected in F1 DNA During 2016
sa16274 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057698 Essential Splice Site 60 500 2 15
Genomic Location:
Chromosome 20 (position 49381886)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGCTCAACCTGGCTTTTCCATAGGTGGCGCTAAAGAGATATTCAGG[T/A]AAACTACTGTACTTTTTATCTAATATTCTGCCATTTCTTTTTTTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057698 Nonsense 87 500 4 15
Genomic Location:
Chromosome 20 (position 49379603)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAAGACATTATTCTGTCATAATTGTCTTTATATTAGAGGCAGCGCTG[C/T]AGAAGATCTTTGAACCCATGACTTCTGTTACGGATGAAGCTCAGTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057698 Essential Splice Site 369 500 13 15
Genomic Location:
Chromosome 20 (position 49358781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGATTTATTTGTGCTTCAGAAACCGTATAACTTTCTGTWTATTCTC[A/T]GGAGACTGGAGGTGCGTGTGGCGGTGTCGTCAGATATCCCAGCAGTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link