C20orf26 (1 of 2)

Ensembl ID:
ENSDARG00000039491
Description:
chromosome 20 open reading frame 26 [Source:HGNC Symbol;Acc:15872]
Human Orthologue:
C20orf26
Human Description:
chromosome 20 open reading frame 26 [Source:HGNC Symbol;Acc:15872]
Mouse Orthologue:
4930529M08Rik
Mouse Description:
RIKEN cDNA 4930529M08 gene Gene [Source:MGI Symbol;Acc:MGI:1926024]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16274 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057698 Essential Splice Site 369 500 13 15
Genomic Location:
Chromosome 20 (position 49358781)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGGATTTATTTGTGCTTCAGAAACCGTATAACTTTCTGTWTATTCTC[A/T]GGAGACTGGAGGTGCGTGTGGCGGTGTCGTCAGATATCCCAGCAGTCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9bclzgx0