pitpna

Ensembl ID:
ENSDARG00000039490
ZFIN ID:
ZDB-GENE-040426-744
Description:
phosphatidylinositol transfer protein alpha isoform [Source:RefSeq peptide;Acc:NP_957229]
Human Orthologues:
PITPNA, PITPNB, PITPNM3
Human Descriptions:
phosphatidylinositol transfer protein, alpha [Source:HGNC Symbol;Acc:9001]
phosphatidylinositol transfer protein, beta [Source:HGNC Symbol;Acc:9002]
PITPNM family member 3 [Source:HGNC Symbol;Acc:21043]
Mouse Orthologues:
Pitpna, Pitpnb
Mouse Descriptions:
phosphatidylinositol transfer protein, alpha Gene [Source:MGI Symbol;Acc:MGI:99887]
phosphatidylinositol transfer protein, beta Gene [Source:MGI Symbol;Acc:MGI:1927542]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22661 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22661
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057257 Nonsense 99 271 5 11
ENSDART00000057697 Splice Site None 271 None 12
ENSDART00000132028 Splice Site None 271 None 12
Genomic Location (Zv9):
Chromosome 15 (position 27768319)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28486559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTTTTTTTTTTTTTTGTAAATCAAATCTGTTCTGTGTCTCTTTTA[C/T]AGAATGAGTACATGAAGGACAATTTTCTAATCATGATTGAGACGTGGCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link