LOC568935

Ensembl ID:
ENSDARG00000039489
Human Orthologue:
GIT1
Human Description:
G protein-coupled receptor kinase interacting ArfGAP 1 [Source:HGNC Symbol;Acc:4272]
Mouse Orthologue:
Git1
Mouse Description:
G protein-coupled receptor kinase-interactor 1 Gene [Source:MGI Symbol;Acc:MGI:1927140]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35903 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057696 Nonsense 224 752 7 20
Genomic Location (Zv9):
Chromosome 15 (position 27811457)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 28529697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAAGCGGGTCACGTGGAGTTGGCCGAACGCTTGGTGGAGTGTCAGTA[T/A]GAGCTCACGGACAGACTGGCCTTCTACCTGTGTGGACGTCGCCCAGGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link