bag3

Ensembl ID:
ENSDARG00000039486
ZFIN ID:
ZDB-GENE-040801-40
Description:
BAG family molecular chaperone regulator 3 [Source:RefSeq peptide;Acc:NP_001003533]
Human Orthologue:
BAG3
Human Description:
BCL2-associated athanogene 3 [Source:HGNC Symbol;Acc:939]
Mouse Orthologue:
Bag3
Mouse Description:
BCL2-associated athanogene 3 Gene [Source:MGI Symbol;Acc:MGI:1352493]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22301 Essential Splice Site Available for shipment Available now
sa38940 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35490 Nonsense Mutation detected in F1 DNA During 2017
sa6304 Nonsense Mutation detected in F1 DNA During 2017
sa42208 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057689 Essential Splice Site 64 480 1 4
Genomic Location (Zv9):
Chromosome 13 (position 25710771)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25356431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAATCGCACAACGACGTGGAACGATCCGCGGCACGATACGAAAAAG[G/A]TAAGACCGACCCTGCTTTTGCTTTTGCGAAGTTGCGTTGTCAAACGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38940
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057689 Essential Splice Site 263 480 3 4
Genomic Location (Zv9):
Chromosome 13 (position 25719711)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25365371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGAGCCCAGTCGCCAGTCATGGCTCAGATCATGGGAGAGAGGCCTCAG[G/A]TATGTGTGTTATTTATCAAGAGGATATTTTACTGAAAGATGAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057689 Nonsense 310 480 4 4
Genomic Location (Zv9):
Chromosome 13 (position 25721321)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25366981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTCAAAGAGTGAGTGAAGTTCCCCAGCAGATACATCATCAGCCAGTA[C/T]AACAACAACAACAACCTACACAGCAGCCTCAGCCAAAAGCACAACCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057689 Nonsense 314 480 4 4
Genomic Location (Zv9):
Chromosome 13 (position 25721333)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25366993
KASP Assay ID:
554-5207.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTGAAGTTCCCCAGCAGATACATCATCAGCCAGTNNNNNNACAACAACAA[C/T]AACCTACACAGCAGCCTCAGCCAAAAGCACAACCYTCCCCGCAGGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42208
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057689 Nonsense 338 480 4 4
Genomic Location (Zv9):
Chromosome 13 (position 25721405)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25367065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAGCACAACCCTCCCCGCAGGTATCAGAAACATCCAATATTACCATA[C/T]AAGTTCCTCCAGCACCAGAGCCCCAGGAAACAGCTGCTCCTCAAACGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link