si:ch211-1n9.6

Ensembl ID:
ENSDARG00000039468
ZFIN ID:
ZDB-GENE-090313-70
Description:
Novel tripartite motif-containing protein [Source:UniProtKB/TrEMBL;Acc:B8A5D5]
Human Orthologues:
TRIM16, TRIM16L, TRIM25, TRIM29, TRIM47, TRIM8
Human Descriptions:
tripartite motif-containing 16 [Source:HGNC Symbol;Acc:17241]
tripartite motif-containing 16-like [Source:HGNC Symbol;Acc:32670]
tripartite motif-containing 25 [Source:HGNC Symbol;Acc:12932]
tripartite motif-containing 29 [Source:HGNC Symbol;Acc:17274]
tripartite motif-containing 47 [Source:HGNC Symbol;Acc:19020]
tripartite motif-containing 8 [Source:HGNC Symbol;Acc:15579]
Mouse Orthologues:
4933422H20Rik, Trim16, Trim25, Trim29, Trim47, Trim8
Mouse Descriptions:
RIKEN cDNA 4933422H20 gene Gene [Source:MGI Symbol;Acc:MGI:3588186]
tripartite motif-containing 16 Gene [Source:MGI Symbol;Acc:MGI:2137356]
tripartite motif-containing 25 Gene [Source:MGI Symbol;Acc:MGI:102749]
tripartite motif-containing 29 Gene [Source:MGI Symbol;Acc:MGI:1919419]
tripartite motif-containing 47 Gene [Source:MGI Symbol;Acc:MGI:1917374]
tripartite motif-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1933302]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16387 Essential Splice Site Available for shipment Available now
sa42184 Nonsense Mutation detected in F1 DNA During 2017
sa30971 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101060 Essential Splice Site 318 545 6 7
ENSDART00000139353   None 61 None 1
Genomic Location (Zv9):
Chromosome 13 (position 22955852)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22685190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCATGCAATGATGCATTGGTTTCAAAATGAATCTYACTTAAGTTCTCA[G/T]GTRAAATTGCCGYTTGTGTCTGTGAAAGASCAAGAGSACAGCACTAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101060 Nonsense 411 545 7 7
ENSDART00000139353   None 61 None 1
ENSDART00000101060 Nonsense 411 545 7 7
ENSDART00000139353   None 61 None 1
Genomic Location (Zv9):
Chromosome 13 (position 22955493)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22684831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGAGAAAGCAAATATCTGCTCTCAGTACAGCGTACGGGCCAAAGAG[A/T]GATTCTGCTCTGGCCTCCACTACTGGGAAGTGGCTGTTTGGAGGAAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101060 Nonsense 411 545 7 7
ENSDART00000139353   None 61 None 1
ENSDART00000101060 Nonsense 411 545 7 7
ENSDART00000139353   None 61 None 1
Genomic Location (Zv9):
Chromosome 13 (position 22955493)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22684831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGAGAAAGCAAATATCTGCTCTCAGTACAGCGTACGGGCCAAAGAG[A/T]GATTCTGCTCTGGCCTCCACTACTGGGAAGTGGCTGTTTGGAGGAAACCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link