tspan15

Ensembl ID:
ENSDARG00000039455
ZFIN ID:
ZDB-GENE-050417-295
Description:
tetraspanin-15 [Source:RefSeq peptide;Acc:NP_001017773]
Human Orthologue:
TSPAN15
Human Description:
tetraspanin 15 [Source:HGNC Symbol;Acc:23298]
Mouse Orthologue:
Tspan15
Mouse Description:
tetraspanin 15 Gene [Source:MGI Symbol;Acc:MGI:1917673]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15593 Nonsense Available for shipment Available now
sa35477 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28103 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057641 Nonsense 40 296 2 8
ENSDART00000143112 Nonsense 40 250 2 7
Genomic Location (Zv9):
Chromosome 13 (position 23093444)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22822782
KASP Assay ID:
2260-6348.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGTTTTGTTTTAGTTGATCGGGGGCTTTATATTGGCCATCRGTATTTA[T/A]GCCGAGGTGGAGAGGCAACGATACAAAACATTGGAAGGAGYGTTTCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057641 Essential Splice Site 91 296 3 8
ENSDART00000143112 Essential Splice Site 91 250 3 7
Genomic Location (Zv9):
Chromosome 13 (position 23089052)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22818390
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTAATATGTCTGTTTCACTTGAGAACCACTGTTTACTCTTGTCTTGCA[G/T]TTTCTTTACATGCTGGCTCTCTGTCTCGTTTTGGAGCTCGTCGGTGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057641 Essential Splice Site 147 296 4 8
ENSDART00000143112 Essential Splice Site 147 250 4 7
Genomic Location (Zv9):
Chromosome 13 (position 23088332)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22817670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATGATGACCTTGATTTCAAAAACATCATGGACTTTGTTCAGAAAACGG[T/G]AAGCGATTTCTATCAGGGTGCACATGAAAGTTGCAGAATTGATATGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link