hk1

Ensembl ID:
ENSDARG00000039452
ZFIN ID:
ZDB-GENE-040426-2848
Description:
hexokinase-1 [Source:RefSeq peptide;Acc:NP_998417]
Human Orthologue:
HK1
Human Description:
hexokinase 1 [Source:HGNC Symbol;Acc:4922]
Mouse Orthologue:
Hk1
Mouse Description:
hexokinase 1 Gene [Source:MGI Symbol;Acc:MGI:96103]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28104 Essential Splice Site Mutation detected in F1 DNA During 2015
sa18424 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057638 Essential Splice Site 165 918 4 18
Genomic Location:
Chromosome 13 (position 23128377)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGGGCTTCACCTTCTCATTTCCTTGTTCACAAAGCAAACTGGATGAG[G/A]TAACAGAGAATCATTCACTCGTTAAATTCATTGTTCTACTACTGTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18424
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057638 Nonsense 191 918 5 18
Genomic Location:
Chromosome 13 (position 23128178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCAAGGTTAATGGAGTAGAGGGAATGGATGTAGTGMAGCTTCTCAAT[A/T]AGGCCATTAAAAAACGTGGAGTGAGTATTATYAAGTCATTCTTTCTATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9uyhoqkr