crfb9

Ensembl ID:
ENSDARG00000039439
ZFIN ID:
ZDB-GENE-060512-349
Description:
interleukin-22 receptor subunit alpha-2 [Source:RefSeq peptide;Acc:NP_001038744]
Human Orthologues:
IL22RA1, IL22RA2
Human Descriptions:
interleukin 22 receptor, alpha 1 [Source:HGNC Symbol;Acc:13700]
interleukin 22 receptor, alpha 2 [Source:HGNC Symbol;Acc:14901]
Mouse Orthologues:
Il22ra1, Il22ra2
Mouse Descriptions:
interleukin 22 receptor, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2663588]
interleukin 22 receptor, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:2665114]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13952 Essential Splice Site Available for shipment Available now
sa18241 Nonsense Available for shipment Available now
sa18524 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13952
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057619 Essential Splice Site 28 238 2 6
Genomic Location:
Chromosome 13 (position 23847696)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYAAACCATCYRCTGYATTTCAATRAAAARCTGCATTTCTWCTCTCTTCC[A/T]GGTAGCMCCACTCAGCAGGAAGAARTGGCTCCAACCGAAGTACAGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057619 Nonsense 64 238 2 6
Genomic Location:
Chromosome 13 (position 23847806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCGAAWTGTCTTACATTGGAAACATCAGYACAAAGCTTCCAAAAACT[T/A]GAAATATTTTSTTCAGCATAAAATGTAAGCCTGCGTCTCTCAASCCTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18524
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057619 Essential Splice Site 72 238 3 6
Genomic Location:
Chromosome 13 (position 23847917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTTGATGAAWTCTCAAAATGTTCATGCATWTCCCTCAYCTTCATTTT[A/G]GACATGGAGACAAAGAGTGGAGCAATTCCAAACAYTGTCAGGGCATCCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bstllcry