il13ra2

Ensembl ID:
ENSDARG00000039436
ZFIN ID:
ZDB-GENE-030521-10
Description:
interleukin-13 receptor subunit alpha-2 [Source:RefSeq peptide;Acc:NP_001107203]
Human Orthologues:
IL13RA1, IL13RA2, IL5RA
Human Descriptions:
interleukin 13 receptor, alpha 1 [Source:HGNC Symbol;Acc:5974]
interleukin 13 receptor, alpha 2 [Source:HGNC Symbol;Acc:5975]
interleukin 5 receptor, alpha [Source:HGNC Symbol;Acc:6017]
Mouse Orthologues:
Il13ra1, Il13ra2, Il5ra
Mouse Descriptions:
interleukin 13 receptor, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:105052]
interleukin 13 receptor, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:1277954]
interleukin 5 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:96558]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14818 Nonsense Available for shipment Available now
sa25305 Nonsense Mutation detected in F1 DNA During 2014
sa8196 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 212 407 5 10
Genomic Location:
Chromosome 5 (position 38707036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATGAGAGAGGATGCAGGTTTCCTCGCCAATCACTCTTGGAGTTTTCC[A/T]AGTTTAATATGTGTGTCAACGGATCTTCTTCAACAGGGAGTCTAAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 266 407 6 10
Genomic Location:
Chromosome 5 (position 38706765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAGAGACTGATGGACGGTTGAAGTTAGAATGGGCGCCACCTAGCGGT[C/T]AGGTGCCAGAACACTGCTTGGATTATGAGGTGGAGAGCAGCACTCTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8196
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 274 407 6 10
Genomic Location:
Chromosome 5 (position 38706739)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGAATGGGCGCCACCTAGCGGTCAGGTGCCAGAACACTGCTTGGATTA[T/A]GAGGTGGAGAGCAGCACTCTAATGGCAAATGGCAAAGAACTGAAGGTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mlxit91o