il13ra2

Ensembl ID:
ENSDARG00000039436
ZFIN ID:
ZDB-GENE-030521-10
Description:
interleukin-13 receptor subunit alpha-2 [Source:RefSeq peptide;Acc:NP_001107203]
Human Orthologues:
IL13RA1, IL13RA2, IL5RA
Human Descriptions:
interleukin 13 receptor, alpha 1 [Source:HGNC Symbol;Acc:5974]
interleukin 13 receptor, alpha 2 [Source:HGNC Symbol;Acc:5975]
interleukin 5 receptor, alpha [Source:HGNC Symbol;Acc:6017]
Mouse Orthologues:
Il13ra1, Il13ra2, Il5ra
Mouse Descriptions:
interleukin 13 receptor, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:105052]
interleukin 13 receptor, alpha 2 Gene [Source:MGI Symbol;Acc:MGI:1277954]
interleukin 5 receptor, alpha Gene [Source:MGI Symbol;Acc:MGI:96558]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40503 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14818 Nonsense Available for shipment Available now
sa25305 Nonsense Mutation detected in F1 DNA During 2016
sa33654 Nonsense Mutation detected in F1 DNA During 2016
sa40502 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa40503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Essential Splice Site 85 407 2 10
Genomic Location (Zv9):
Chromosome 5 (position 38714309)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36513993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCGATACCAGCTCCGATACTTTGACACCTACGAGGAGCGATGGAGG[G/A]TGAGAATCCACCCACAAAACAGGCCTCACACACATTTATTTTCATTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 212 407 5 10
Genomic Location (Zv9):
Chromosome 5 (position 38707036)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36506720
KASP Assay ID:
2259-6195.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAATGAGAGAGGATGCAGGTTTCCTCGCCAATCACTCTTGGAGTTTTCC[A/T]AGTTTAATATGTGTGTCAACGGATCTTCTTCAACAGGGAGTCTAAGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 266 407 6 10
Genomic Location (Zv9):
Chromosome 5 (position 38706765)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36506449
KASP Assay ID:
554-7499.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAGAGACTGATGGACGGTTGAAGTTAGAATGGGCGCCACCTAGCGGT[C/T]AGGTGCCAGAACACTGCTTGGATTATGAGGTGGAGAGCAGCACTCTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 295 407 7 10
Genomic Location (Zv9):
Chromosome 5 (position 38703404)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36503088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCAATCTGTGTTATTTTTATTTTCTTCTTTCAGCAAACGGAGATTCTG[G/T]AGAATCTGGATCTGGGCACATCTTATGAGCTCCCGAGAGAAGCAGAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40502
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057613 Nonsense 390 407 10 10
Genomic Location (Zv9):
Chromosome 5 (position 38702356)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36502040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGCTGCATAAAGCCGTGCAGCAAGAAGGATGTCATCTACACGCTGTA[C/A]AAGCAGAAGGTCAACGAGAACATGCCTTCAATCTTCAGCCCCATTTTCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link