dmrta2

Ensembl ID:
ENSDARG00000039412
ZFIN IDs:
ZDB-GENE-021220-7, ZDB-GENE-021220-8, ZDB-GENE-041116-2
Description:
Doublesex- and mab-3-related transcription factor A2 [Source:UniProtKB/Swiss-Prot;Acc:Q5UU75]
Human Orthologue:
DMRTA2
Human Description:
DMRT-like family A2 [Source:HGNC Symbol;Acc:13908]
Mouse Orthologue:
Dmrta2
Mouse Description:
doublesex and mab-3 related transcription factor like family A2 Gene [Source:MGI Symbol;Acc:MGI:2653

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13156 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057590 Nonsense 53 440 1 2
Genomic Location (Zv9):
Chromosome 8 (position 16778283)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16223171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAGCCTGTTAAGGGCCCCRCCGCWGTTGCTTCGCGCTACGGAGAAGTA[T/A]CCAAGGACGCCCAAGTGCGCCCGGTGCAGGAATCACGGCGTGGTATCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link