cep68

Ensembl ID:
ENSDARG00000039411
ZFIN ID:
ZDB-GENE-030616-565
Description:
centrosomal protein 68 [Source:RefSeq peptide;Acc:NP_001007172]
Human Orthologue:
CEP68
Human Description:
centrosomal protein 68kDa [Source:HGNC Symbol;Acc:29076]
Mouse Orthologue:
Cep68
Mouse Description:
centrosomal protein 68 Gene [Source:MGI Symbol;Acc:MGI:2667663]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22289 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057588 Nonsense 164 650 3 6
ENSDART00000125949 Nonsense 164 685 2 6
ENSDART00000147514 None None 126 None 4
Genomic Location:
Chromosome 13 (position 24648860)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGGGTGGTCATGTGACGAGGATACTATTTTTAACACTTCAGCTGAC[A/T]AACGCAGTCTGTCCAGTCCGCCCTCTGCTTTTCTGAGCCTGACAGCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4u54u851