cep68

Ensembl ID:
ENSDARG00000039411
ZFIN ID:
ZDB-GENE-030616-565
Description:
centrosomal protein 68 [Source:RefSeq peptide;Acc:NP_001007172]
Human Orthologue:
CEP68
Human Description:
centrosomal protein 68kDa [Source:HGNC Symbol;Acc:29076]
Mouse Orthologue:
Cep68
Mouse Description:
centrosomal protein 68 Gene [Source:MGI Symbol;Acc:MGI:2667663]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22289 Nonsense Available for shipment Available now
sa35481 Nonsense Available for shipment Available now
sa44786 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22289
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057588 Nonsense 164 650 3 6
ENSDART00000125949 Nonsense 164 685 2 6
ENSDART00000147514   None 126 None 4
Genomic Location (Zv9):
Chromosome 13 (position 24648860)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24294520
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGGGTGGTCATGTGACGAGGATACTATTTTTAACACTTCAGCTGAC[A/T]AACGCAGTCTGTCCAGTCCGCCCTCTGCTTTTCTGAGCCTGACAGCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35481
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057588 Nonsense 389 650 3 6
ENSDART00000125949 Nonsense 389 685 2 6
ENSDART00000147514   None 126 None 4
Genomic Location (Zv9):
Chromosome 13 (position 24648183)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 24293843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTTGTCCTTTGAAAGCCTTGACTGTGATGCAAAGTCAAGGGGTCACTA[T/G]CGCAAATGGGGTGTCTTTTCGACATATGGATCTGCCCCTACTTTTATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057588 Nonsense 392 650 3 6
ENSDART00000125949 Nonsense 392 685 2 6
ENSDART00000147514   None 126 None 4
Genomic Location (Zv9):
Chromosome 13 (position 24648175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGAAAGCCTTGACTGTGATGCAAAGTCAAGGGGTCACTATCGCAAAT[G/A]GGGTGTCTTTTCGACATATGGATCTGCCCCTACTTTTATTAGATCAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link