prom2

Ensembl ID:
ENSDARG00000039406
ZFIN ID:
ZDB-GENE-080723-16
Description:
Novel protein with a Prominin domain [Source:UniProtKB/TrEMBL;Acc:B8JMY4]
Human Orthologue:
PROM2
Human Description:
prominin 2 [Source:HGNC Symbol;Acc:20685]
Mouse Orthologue:
Prom2
Mouse Description:
prominin 2 Gene [Source:MGI Symbol;Acc:MGI:2138997]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22320 Nonsense Available for shipment Available now
sa19062 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10151 Essential Splice Site Available for shipment Available now
sa35508 Essential Splice Site Available for shipment Available now
sa28123 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101633 Nonsense 72 830 1 23
ENSDART00000136318 Nonsense 72 72 2 2
ENSDART00000146581   None 507 None 16
Genomic Location (Zv9):
Chromosome 13 (position 28972348)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28618296
KASP Assay ID:
2260-6500.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAATCGTACATTCATTCCTGGGACTTGTCCAGCCCAATCCATTCCCT[A/T]AAGGTGAGTGTTTTGTGATGCAGTTTTGGTGTGTTTGGCAAAGGCGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19062
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101633 Essential Splice Site 344 830 8 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 21 507 1 16
ENSDART00000101633 Essential Splice Site 344 830 8 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 21 507 1 16
Genomic Location (Zv9):
Chromosome 13 (position 28985663)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28631611
KASP Assay ID:
2260-6501.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCGTAGACAAGGCTAGAAATGCTGATGTCATCGGACAGGCAAATAAG[G/T]TTAGTGCCTCTTTTAAATTTTTGGTAAATTTTAAAAGAAGTTTCAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101633 Essential Splice Site 344 830 8 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 21 507 1 16
ENSDART00000101633 Essential Splice Site 344 830 8 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 21 507 1 16
Genomic Location (Zv9):
Chromosome 13 (position 28985663)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28631611
KASP Assay ID:
2260-6501.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCGTAGACAAGGCTAGAAATGCTGATGTCATCGGACARGCAAATAAG[G/T]TTAGTGCCTCTTTTAAATTTTTGGWAAATTTTAAAAGAAGTTTCAGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35508
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101633 Essential Splice Site 366 830 9 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 43 507 2 16
ENSDART00000101633 Essential Splice Site 366 830 9 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 43 507 2 16
Genomic Location (Zv9):
Chromosome 13 (position 28986063)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28632011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTATTCCACAAAAGGTGAAAAATGAGACCCAAGGAAGTGTGGAGTG[T/A]AAGTTTGTGTTATTTGACTTAACCCCATCTAACTTACATATGTGTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28123
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101633 Essential Splice Site 366 830 9 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 43 507 2 16
ENSDART00000101633 Essential Splice Site 366 830 9 23
ENSDART00000136318   None 72 None 2
ENSDART00000146581 Essential Splice Site 43 507 2 16
Genomic Location (Zv9):
Chromosome 13 (position 28986063)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28632011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAGTATTCCACAAAAGGTGAAAAATGAGACCCAAGGAAGTGTGGAGTG[T/A]AAGTTTGTGTTATTTGACTTAACCCCATCTAACTTACATATGTGTTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link