polr1c

Ensembl ID:
ENSDARG00000039400
ZFIN ID:
ZDB-GENE-040426-1495
Description:
DNA-directed RNA polymerases I and III subunit RPAC1 [Source:RefSeq peptide;Acc:NP_956860]
Human Orthologue:
POLR1C
Human Description:
polymerase (RNA) I polypeptide C, 30kDa [Source:HGNC Symbol;Acc:20194]
Mouse Orthologue:
Polr1c
Mouse Description:
polymerase (RNA) I polypeptide C Gene [Source:MGI Symbol;Acc:MGI:103288]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22319 Nonsense Available for shipment Available now
sa31932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057575 Nonsense 295 347 8 9
ENSDART00000128246 Nonsense 310 362 8 9
ENSDART00000137475   None 197 None 5
ENSDART00000057575 Nonsense 295 347 8 9
ENSDART00000128246 Nonsense 310 362 8 9
ENSDART00000137475   None 197 None 5
Genomic Location (Zv9):
Chromosome 13 (position 28918038)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28563986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCCGTTTGGACACATGCAGCAGAGAAGTTCTCCGCCATGATGACTTG[A/T]AGAGCTTGGTGAAACTGGGAAGAGTGCGGGATCATTTTATATGTACGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057575 Nonsense 295 347 8 9
ENSDART00000128246 Nonsense 310 362 8 9
ENSDART00000137475   None 197 None 5
ENSDART00000057575 Nonsense 295 347 8 9
ENSDART00000128246 Nonsense 310 362 8 9
ENSDART00000137475   None 197 None 5
Genomic Location (Zv9):
Chromosome 13 (position 28918038)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28563986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAGCCGTTTGGACACATGCAGCAGAGAAGTTCTCCGCCATGATGACTTG[A/T]AGAGCTTGGTGAAACTGGGAAGAGTGCGGGATCATTTTATATGTACGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link