A5WUP3_DANRE

Ensembl ID:
ENSDARG00000039392
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WUP2]
Human Orthologue:
WNK1
Human Description:
WNK lysine deficient protein kinase 1 [Source:HGNC Symbol;Acc:14540]
Mouse Orthologue:
Wnk1
Mouse Description:
WNK lysine deficient protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:2442092]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12971 Nonsense Available for shipment Available now
sa20204 Nonsense Mutation detected in F1 DNA During 2014
sa17370 Nonsense Available for shipment Available now
sa16047 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12971
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012928 Nonsense 450 1909 5 27
ENSDART00000132228 None None 202 None 3
ENSDART00000134887 None None 1089 None 15
ENSDART00000146622 None None 201 None 4

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 4 (position 7275572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTGGCAGTTTCGACAAGGTAGCCATTCCAGAAGTKAAAGAGATCATC[G/T]AGGGATGTATTCGGCAAAACAAAGATGAAAGGTAACTACTGTWCACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012928 Nonsense 674 1909 8 27
ENSDART00000132228 None None 202 None 3
ENSDART00000134887 None None 1089 None 15
ENSDART00000146622 None None 201 None 4

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 4 (position 7272261)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCCAGCTAAGCATGTCGTATAGTTCTCCTGGAACATCCCAACAACAG[C/T]AGGTCCCAGGACAGGGCACCTACACTCCCAGCTCTCAAGCTCCCCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17370
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012928 Nonsense 1209 1909 18 27
ENSDART00000132228 None None 202 None 3
ENSDART00000134887 Nonsense 404 1089 6 15
ENSDART00000146622 None None 201 None 4
Genomic Location:
Chromosome 4 (position 7254573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCACAAGTGCCCCCTCTCCAGCCGGTGACCACAACCATGCCAGTCGTG[C/T]AGCCCACACCAGTGCACAGCCAACCACAGACCACYACCGTGCCCAAKCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012928 Nonsense 1849 1909 27 27
ENSDART00000132228 Nonsense 142 202 3 3
ENSDART00000134887 Nonsense 1029 1089 15 15
ENSDART00000146622 Nonsense 169 201 4 4
Genomic Location:
Chromosome 4 (position 7229251)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTAGGAGMTCGGAAGGGCTCCTTGTGTCCCACGCCGCAGTACGGCTA[C/A]CCCTCCGCACCTTACAGCGCCCAGTGGGCTGGAGCGGCCACGCACACCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r7qnivoh