epha3l

Ensembl ID:
ENSDARG00000039373
ZFIN ID:
ZDB-GENE-060503-862
Description:
Novel protein similar to vertebrate EPH receptor A3 (EPHA3) [Source:UniProtKB/TrEMBL;Acc:Q1L8W1]
Human Orthologue:
EPHA3
Human Description:
EPH receptor A3 [Source:HGNC Symbol;Acc:3387]
Mouse Orthologue:
Epha3
Mouse Description:
Eph receptor A3 Gene [Source:MGI Symbol;Acc:MGI:99612]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18943 Essential Splice Site Mutation detected in F1 DNA During 2014
sa10403 Essential Splice Site Available for shipment Available now
sa8333 Nonsense Mutation detected in F1 DNA During 2014
sa25420 Nonsense Mutation detected in F1 DNA During 2014
sa11139 Nonsense Available for shipment Available now
sa16865 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Essential Splice Site 52 712 1 14
ENSDART00000006787 Essential Splice Site 52 712 1 14
Genomic Location:
Chromosome 9 (position 16828387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAATTACTTTCGAGCAGACGAGGACCCTGCCTCCATGGCCTGCTCTC[G/A]TACGTGCTCTTATCTTACATACCCACATGTTTGTTTTGTTTAAACTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Essential Splice Site 52 712 1 14
ENSDART00000006787 Essential Splice Site 52 712 1 14
Genomic Location:
Chromosome 9 (position 16828387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAYTACTTTCGAGCAGACGAGGACCCTGCCTCCATGGCCTGCTCTC[G/A]TACGTGCTCTTATCTTACATACCCACATGTTTGTTTTGYTTAAACTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 204 712 3 14
Genomic Location:
Chromosome 9 (position 16855206)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCAGAGAGACCCAATGGAATAATTCTGGACTATGAGGTCAAATACTA[T/A]GAGAAGGTGGGAGCAGTTTAATTTAGTCTCGCTTAGGGCACTCGCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 239 712 4 14
Genomic Location:
Chromosome 9 (position 16867048)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTACACTGAACGGACTGAAACCTGACACCACCTACCTGCTGCAGATC[A/T]GAGCTCGTACTGCTGCCGGTTACGGCAGCAGCAGCCGCAAGTTTGAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 496 712 10 14
Genomic Location:
Chromosome 9 (position 16885671)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACATCCTGGTCAACAGCAATCTAKTGTGTAAAGTGTCAGACTTCGGCT[T/A]GTCCAGAGTGTTAGAGGATGACCCAGAAGCGGMCTACACAACAAGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16865
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 508 712 10 14
Genomic Location:
Chromosome 9 (position 16885708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACTTCGGCTWGTCCAGAGTGTTAGAGGATGACCCAGAAGCGGMCTA[C/A]ACAACAAGAGTAAGTTAACAYCTGTAGGAAMAAGGAGAGTTTTTTTTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Orofacial clefts: Genome-wide meta-analyses of nonsyndromic cleft lip with or without cleft palate identify six new risk loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/viq3buo5