dnajb12

Ensembl ID:
ENSDARG00000039363
ZFIN ID:
ZDB-GENE-030131-2725
Description:
dnaJ homolog subfamily B member 12 [Source:RefSeq peptide;Acc:NP_997824]
Human Orthologue:
DNAJB12
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 12 [Source:HGNC Symbol;Acc:14891]
Mouse Orthologue:
Dnajb12
Mouse Description:
DnaJ (Hsp40) homolog, subfamily B, member 12 Gene [Source:MGI Symbol;Acc:MGI:1931881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15775 Nonsense Available for shipment Available now
sa6308 Nonsense Mutation detected in F1 DNA During 2017
sa10890 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Nonsense 156 371 4 9
ENSDART00000136622 Nonsense 50 233 2 6
Genomic Location (Zv9):
Chromosome 13 (position 30262516)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29908464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCATTTGTTTTGTTTTTTTGGACTTCCAAYAGCTATAGGTAATGCGTA[C/A]GCAGTTCTTAGTAACCCTGAAAAAAGAAGGCAGTAWGATGTCTAMGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Nonsense 168 371 4 9
ENSDART00000136622 Nonsense 62 233 2 6
Genomic Location (Zv9):
Chromosome 13 (position 30262552)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29908500
KASP Assay ID:
554-4783.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGGTAATGCGTACGCAGTTCTTAGTAACCCTGAAAAAAGAAGGCAGTA[T/A]GATGTCTACGGTGAAGAAAAAGCTCAYCCTACTCACAGGCACAGGACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10890
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Nonsense 171 371 4 9
ENSDART00000136622 Nonsense 65 233 2 6
Genomic Location (Zv9):
Chromosome 13 (position 30262561)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29908509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTACGCAGTTCTTAGTAACCCTGAAAAAAGAAGGCAGTAWGATGTCTA[C/A]GGTGAAGAAAAAGCTCAYCCTACTCACAGGCACAGGACCTATCATAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link