si:ch211-26a17.7

Ensembl ID:
ENSDARG00000039349
ZFIN ID:
ZDB-GENE-090313-105
Description:
Novel protein similar to H.sapiens GPR103, G protein-coupled receptor 103 (GPR103) [Source:UniProtKB
Human Orthologue:
QRFPR
Human Description:
pyroglutamylated RFamide peptide receptor [Source:HGNC Symbol;Acc:15565]
Mouse Orthologues:
C130060K24Rik, Qrfpr
Mouse Descriptions:
pyroglutamylated RFamide peptide receptor Gene [Source:MGI Symbol;Acc:MGI:2677633]
RIKEN cDNA C130060K24 gene Gene [Source:MGI Symbol;Acc:MGI:2441881]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24937 Nonsense Mutation detected in F1 DNA During 2017
sa38948 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42220 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24937
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041026 Nonsense 16 355 1 6
ENSDART00000133049 Nonsense 16 295 1 5
Genomic Location (Zv9):
Chromosome 13 (position 30439613)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30085561
KASP Assay ID:
554-7383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACATGGGGGATAAGAAGATTACTCCTGAAGTGCTGGAGCAACTACTG[C/T]AGTTTTACAATCTTACCCGTCAGGAGTTCATCGAGACGTACCAGATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041026 Essential Splice Site 266 355 None 6
ENSDART00000133049 Essential Splice Site 266 295 None 5
Genomic Location (Zv9):
Chromosome 13 (position 30448825)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30094773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATACACAACTGTACGTAAATGATGTACCTAATCCCTCTTTATGCTTC[A/T]GAAAGAAGCGAAGAGCAATCAAGATGATGGTCACCATTGTCGTGCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041026 Nonsense 340 355 6 6
ENSDART00000133049   None 295 None 5
Genomic Location (Zv9):
Chromosome 13 (position 30449130)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30095078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATTCATTCAACAATCCCATTATCTATGCTTTTATGAATGAAAACTTC[C/T]AGAAGAACTGCATGTCCACGCTTTCTGTTTGCATTAGGAGGTCCAGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link