rps24

Ensembl ID:
ENSDARG00000039347
ZFIN ID:
ZDB-GENE-040109-5
Description:
40S ribosomal protein S24 isoform 1 [Source:RefSeq peptide;Acc:NP_001012316]
Human Orthologue:
RPS24
Human Description:
ribosomal protein S24 [Source:HGNC Symbol;Acc:10411]
Mouse Orthologue:
Rps24
Mouse Description:
ribosomal protein S24 Gene [Source:MGI Symbol;Acc:MGI:98147]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2681 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa2681
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100813 Nonsense 105 132 4 6
ENSDART00000133404 Nonsense 93 119 4 5
ENSDART00000141945 Nonsense 93 119 4 5
ENSDART00000147729 Nonsense 105 131 4 5

The following transcripts of ENSDARG00000039347 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 30456786)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 30102734
KASP Assay ID:
554-2575.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCTTTATTCTTCAGCATGGCCTTTATGAGAAGAAAAAGACATCCAGA[A/T]AACAGCGCAAGGAACGCAAGAACAGAATGAAGAAAGTTAGAGGCATCAAG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
gut
ZFA:0000112
quality
PATO:0000001
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pectoral fin
ZFA:0001161
malformed
PATO:0000646
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
pericardium
ZFA:0000054
edematous
PATO:0001450
abnormal
PATO:0000460
Larval:Day 5
ZFS:0000037
yolk
ZFA:0000084
increased size
PATO:0000586
abnormal
PATO:0000460

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link