drg1

Ensembl ID:
ENSDARG00000039345
ZFIN ID:
ZDB-GENE-030131-8767
Description:
developmentally-regulated GTP-binding protein 1 [Source:RefSeq peptide;Acc:NP_956332]
Human Orthologue:
DRG1
Human Description:
developmentally regulated GTP binding protein 1 [Source:HGNC Symbol;Acc:3029]
Mouse Orthologue:
Drg1
Mouse Description:
developmentally regulated GTP binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1343297]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10006 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10006
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057500 Nonsense 261 366 7 9
Genomic Location (Zv9):
Chromosome 10 (position 17716612)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17728958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTCAACAAAATCGACCAAATCTCCATYGAGGAGCTGGACGTTATCTA[C/A]AAAATCCCTCACTGCGTGCCCATCTCCGCTCACCACCGCTGGAACTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link