ahcyl2

Ensembl ID:
ENSDARG00000039343
ZFIN ID:
ZDB-GENE-040115-5
Description:
putative adenosylhomocysteinase 3 [Source:RefSeq peptide;Acc:NP_958497]
Human Orthologue:
AHCYL2
Human Description:
adenosylhomocysteinase-like 2 [Source:HGNC Symbol;Acc:22204]
Mouse Orthologue:
Ahcyl2
Mouse Description:
S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1921590]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33371 Nonsense Mutation detected in F1 DNA During 2016
sa8809 Essential Splice Site Mutation detected in F1 DNA During 2016
sa10583 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Nonsense 156 623 2 17
Genomic Location:
Chromosome 4 (position 4922108)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAAGCAAGAGTTCAACAAACGTCCCACCAAGATCGGCCGCAGGTCTT[T/A]GTCCCGCTCCATCTCACAATCTTCAACGGACAGTTACAGCTCAGGTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Essential Splice Site 581 623 15 17
Genomic Location:
Chromosome 4 (position 4901791)
KASP Assay ID:
2259-4423.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCGAGGGCCGCTACAAACAGGACGTCTACCTGCTGCCGAAGAAAATGG[G/A]TGGGATATTTKTTTTNAGAAATACATGCACAGTAAGATGCTTTGTGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10583
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Nonsense 584 623 16 17
Genomic Location:
Chromosome 4 (position 4899827)
KASP Assay ID:
2259-4422.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
MATGATTCTAGATGATGTGAATTTGCTTATGCWTTTTCTRCAGATGAGTA[T/A]GTGGCCAGCCTTCATCTCCCTACATTTGATGCACACCTGACTGAACTGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Inflammatory biomarkers: A genome-wide association study of inflammatory biomarker changes in response to fenofibrate treatment in the Genetics of Lipid Lowering Drug and Diet Network. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link