si:ch211-240j22.1

Ensembl ID:
ENSDARG00000039340
ZFIN ID:
ZDB-GENE-040914-26
Description:
Novel protein similar to vertebrate transmembrane protein 209 (TMEM209) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
TMEM209
Human Description:
transmembrane protein 209 [Source:HGNC Symbol;Acc:21898]
Mouse Orthologue:
Tmem209
Mouse Description:
transmembrane protein 209 Gene [Source:MGI Symbol;Acc:MGI:1919899]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1264 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1264
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075533 Nonsense 508 563 12 14
ENSDART00000132666   None 251 None 6
ENSDART00000136096 Nonsense 498 551 13 15

The following transcripts of ENSDARG00000039340 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 4970529)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5088710
KASP Assay ID:
554-1179.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAGAACCTGTTCTGCATCCATCAAAGTAGCACAAATCCTCCTCATTA[T/A]CAGCTCGTCTACCAGGGACACGTTTACAGCTTGCCCAAAGTAAGAAGACG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link