LOC100329381

Ensembl ID:
ENSDARG00000039329
Human Orthologue:
GPR180
Human Description:
G protein-coupled receptor 180 [Source:HGNC Symbol;Acc:28899]
Mouse Orthologue:
Gpr180
Mouse Description:
G protein-coupled receptor 180 Gene [Source:MGI Symbol;Acc:MGI:1930949]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10918 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057471 Nonsense 366 386 10 10
ENSDART00000128066 Nonsense 226 241 7 7
Genomic Location:
Chromosome 6 (position 59396128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTCAGTGGTGGTTCTGTATCGACTCTTTCTGTCCCGCAGTCTGTACTG[G/A]GAGGTTTCGTCGCTGTCGTCTGTAACGCTGCCGCTCACCATGAGCCGCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6rxkscc6