si:dkey-21k4.4

Ensembl ID:
ENSDARG00000039319
ZFIN ID:
ZDB-GENE-060526-254
Description:
vacuolar protein sorting-associated protein 37B [Source:RefSeq peptide;Acc:NP_001093466]
Human Orthologue:
VPS37B
Human Description:
vacuolar protein sorting 37 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:25754]
Mouse Orthologue:
Vps37b
Mouse Description:
vacuolar protein sorting 37B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916724]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33613 Nonsense Available for shipment Available now
sa40440 Nonsense Mutation detected in F1 DNA During 2017
sa20430 Nonsense Available for shipment Available now
sa20429 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33613
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078642 Nonsense 61 288 2 4
Genomic Location (Zv9):
Chromosome 5 (position 29654173)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27409471
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGACTCTAGCTAATAACCGTTTCCTGGCTGAACAGAACCTTTTACTC[C/T]AACCCAAACTTGACCACCAAAAGAACGAACTCACCAGACGCTACCGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078642 Nonsense 101 288 3 4
Genomic Location (Zv9):
Chromosome 5 (position 29646268)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27401566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTTCTTTTCTGTTCCCCCACAGATGACAGATTAGGAAATACACCGT[T/A]GGACACATTGCTTGCACTCCTACAAGCAGAAGGGGCCAAAATTGAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078642 Nonsense 140 288 4 4
Genomic Location (Zv9):
Chromosome 5 (position 29645223)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27400521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCGTTCCTCGATGGAGCAGCCCCTCTGGACACATTCATCGATGACTA[T/A]CAGAGCAAGAGGAAGCTGGCGCACCTGCGGCGAGTCAAGATTGAGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078642 Nonsense 163 288 4 4
Genomic Location (Zv9):
Chromosome 5 (position 29645156)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27400454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCGCACCTGCGGCGAGTCAAGATTGAGAAGCTCCAAGAAATGGTGCTA[A/T]AGGGACACCACATGCCCCCGGCTGCACCTCCACCCTCTCGTGCTCAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link