rraga

Ensembl ID:
ENSDARG00000039316
ZFIN ID:
ZDB-GENE-030131-4083
Description:
Ras-related GTP binding A [Source:RefSeq peptide;Acc:NP_956008]
Human Orthologues:
RRAGA, RRAGB
Human Descriptions:
Ras-related GTP binding A [Source:HGNC Symbol;Acc:16963]
Ras-related GTP binding B [Source:HGNC Symbol;Acc:19901]
Mouse Orthologues:
Rraga, Rragb
Mouse Descriptions:
Ras-related GTP binding A Gene [Source:MGI Symbol;Acc:MGI:1915691]
Ras-related GTP binding B Gene [Source:MGI Symbol;Acc:MGI:3038613]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22450 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057449 Essential Splice Site 98 274 2 7
Genomic Location (Zv9):
Chromosome 14 (position 17944294)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 13738747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTGGTACACAAGATGGACCTGGTTCAGGAGGATCAGAGAGATTTG[G/A]TAAGATACTGGCACAATGTCATCTTAAGGTCTATGTATATCAGGAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link