ENSDARG00000039311

Ensembl ID:
ENSDARG00000039311
Human Orthologue:
EDA
Human Description:
ectodysplasin A [Source:HGNC Symbol;Acc:3157]
Mouse Orthologue:
Eda
Mouse Description:
ectodysplasin-A Gene [Source:MGI Symbol;Acc:MGI:1195272]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23025 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057431 Missense 10 60 1 3

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 17 (position 15384362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTTCTCAAAGATGACCTCACCAGGAGGACCAGGTGGGCCGGGAGGTC[C/A]AGAAGGACCTGGAATTCCAGCAGGTCCCTCAGATCCTGGAAGACCAGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fgk32t0z