terfa

Ensembl ID:
ENSDARG00000039302
ZFIN ID:
ZDB-GENE-020419-38
Description:
telomeric repeat-binding factor 2 [Source:RefSeq peptide;Acc:NP_775350]
Human Orthologue:
TERF2
Human Description:
telomeric repeat binding factor 2 [Source:HGNC Symbol;Acc:11729]
Mouse Orthologue:
Terf2
Mouse Description:
telomeric repeat binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1195972]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8169 Essential Splice Site Mutation detected in F1 DNA During 2015
sa26372 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa8169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057423 Essential Splice Site 120 574 3 14
Genomic Location:
Chromosome 4 (position 62068915)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTCCCGCACMCAGAGCAGCAGCTCATACGCCACGCCATCAGCGAGATG[G/A]TGAGTGTGTGTGYGTGTTGRGACTGGGAGTCAATTGCTAAAAGATTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057423 Essential Splice Site 522 574 13 14
Genomic Location:
Chromosome 4 (position 62080656)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTTTCAGCTCCAGCTAAAAAGTACACCAGGAAG[G/A]TGAGTGTGTGTCCTGAGGTTTCATTTGTACAGTACAGTCTGCTGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9v417zp9