terfa

Ensembl ID:
ENSDARG00000039302
ZFIN ID:
ZDB-GENE-020419-38
Description:
telomeric repeat-binding factor 2 [Source:RefSeq peptide;Acc:NP_775350]
Human Orthologue:
TERF2
Human Description:
telomeric repeat binding factor 2 [Source:HGNC Symbol;Acc:11729]
Mouse Orthologue:
Terf2
Mouse Description:
telomeric repeat binding factor 2 Gene [Source:MGI Symbol;Acc:MGI:1195972]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26372 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa26372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057423 Essential Splice Site 522 574 13 14
Genomic Location (Zv9):
Chromosome 4 (position 62080656)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 76611783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTTTCAGCTCCAGCTAAAAAGTACACCAGGAAG[G/A]TGAGTGTGTGTCCTGAGGTTTCATTTGTACAGTACAGTCTGCTGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link