rdh14a

Ensembl ID:
ENSDARG00000039299
ZFIN ID:
ZDB-GENE-041010-124
Description:
retinol dehydrogenase 14a (all-trans/9-cis/11-cis) [Source:RefSeq peptide;Acc:NP_001006031]
Human Orthologue:
RDH14
Human Description:
retinol dehydrogenase 14 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19979]
Mouse Orthologue:
Rdh14
Mouse Description:
retinol dehydrogenase 14 (all-trans and 9-cis) Gene [Source:MGI Symbol;Acc:MGI:1920402]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10672 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10672
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057421 Nonsense 220 286 2 2
ENSDART00000127048 Nonsense 220 286 3 3
Genomic Location:
Chromosome 13 (position 32679601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YCTGGGCAGACATGTCCACATCCCACTGCTGGTGAAGCCTCTGTTTAACT[T/A]GGCATCAAGGGCCTTCTTCAAGTCCCCTGAGGAGGGGGCGCAGACGTCTR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/euqmp8cw