golga5

Ensembl ID:
ENSDARG00000039279
ZFIN ID:
ZDB-GENE-040426-2749
Description:
Golgin subfamily A member 5 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXE4]
Human Orthologue:
GOLGA5
Human Description:
golgin A5 [Source:HGNC Symbol;Acc:4428]
Mouse Orthologue:
Golga5
Mouse Description:
golgi autoantigen, golgin subfamily a, 5 Gene [Source:MGI Symbol;Acc:MGI:1351475]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22341 Nonsense Mutation detected in F1 DNA During 2014
sa4516 Nonsense F2 line generated During 2014
sa9432 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057386 Nonsense 135 760 2 13
ENSDART00000129806 Nonsense 135 760 1 12
Genomic Location:
Chromosome 13 (position 33448392)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAACGACGATTTGCTTTTTGACTTCTTAAACAGTTCAGATCCACCA[C/T]AGAGCGAGAAAAAGGAAGTCAGGAGAGAAACCGTGTCGAAAGCTTTTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4516
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057386 Nonsense 325 760 4 13
ENSDART00000129806 Nonsense 325 760 3 12
Genomic Location:
Chromosome 13 (position 33443842)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCACGGTTCGAGAACTTAGCTCWCAGGTCGATGACCTCACAGAAGCCT[T/A]GTCAGCAAAAGACGGTCAGTTGGCGGTCTTGAAAGTGCGACTGGACGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057386 Nonsense 541 760 8 13
ENSDART00000129806 Nonsense 541 760 7 12
Genomic Location:
Chromosome 13 (position 33439975)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGAYTTTAGGATCTGGAAACCCAAGCGCTCACTGAGAACGAGAGCTGG[A/T]GAGAACAGCTGGCAGAGGTACAGGAACAACAYGCACAGCAGATCAGAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yemo6lyn