fbln5

Ensembl ID:
ENSDARG00000039273
ZFIN ID:
ZDB-GENE-041010-54
Description:
fibulin-5 [Source:RefSeq peptide;Acc:NP_001005979]
Human Orthologue:
FBLN5
Human Description:
fibulin 5 [Source:HGNC Symbol;Acc:3602]
Mouse Orthologue:
Fbln5
Mouse Description:
fibulin 5 Gene [Source:MGI Symbol;Acc:MGI:1346091]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31943 Nonsense Available for shipment Available now
sa22340 Nonsense Available for shipment Available now
sa31942 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Nonsense 134 477 4 11
Genomic Location (Zv9):
Chromosome 13 (position 33392094)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33038042
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTGGCTCCTGTGGCTCCTGGCCCTGGTCCAGGCCCTGGTCCCAGTTA[C/A]CCAATAGTGAGTCGAACCACTCCCTGTCTCCTTGGATATACATTCGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Nonsense 181 477 5 11
Genomic Location (Zv9):
Chromosome 13 (position 33384384)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33030332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATCAGTGTAACCCTACTCAGGTGTGTATAAATACAGCCGGTGGATA[T/A]ACCTGCTCGTGTACTGAGGGCTACTGGCTGGTGGGAGGACAGTGCCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Essential Splice Site 275 477 7 11
Genomic Location (Zv9):
Chromosome 13 (position 33383220)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33029168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGTGATGAAGGCTTTGAGCTTGCCGCTGATGGCACCACCTGCAATG[G/A]TAAAGGAGGAAGATAAGGTCCAGTTTAGAGGTTTTAGAGAAAGTTTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link