fbln5

Ensembl ID:
ENSDARG00000039273
ZFIN ID:
ZDB-GENE-041010-54
Description:
fibulin-5 [Source:RefSeq peptide;Acc:NP_001005979]
Human Orthologue:
FBLN5
Human Description:
fibulin 5 [Source:HGNC Symbol;Acc:3602]
Mouse Orthologue:
Fbln5
Mouse Description:
fibulin 5 Gene [Source:MGI Symbol;Acc:MGI:1346091]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22340 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Nonsense 181 477 5 11
Genomic Location:
Chromosome 13 (position 33384384)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACATCAGTGTAACCCTACTCAGGTGTGTATAAATACAGCCGGTGGATA[T/A]ACCTGCTCGTGTACTGAGGGCTACTGGCTGGTGGGAGGACAGTGCCAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/49qotexd