pls1

Ensembl ID:
ENSDARG00000039272
ZFIN ID:
ZDB-GENE-030131-6205
Description:
plastin-1 [Source:RefSeq peptide;Acc:NP_956175]
Human Orthologue:
PLS1
Human Description:
plastin 1 [Source:HGNC Symbol;Acc:9090]
Mouse Orthologue:
Pls1
Mouse Description:
plastin 1 (I-isoform) Gene [Source:MGI Symbol;Acc:MGI:104809]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19675 Essential Splice Site Available for shipment Available now
sa30813 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39771 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057381 Essential Splice Site 77 628 3 17
ENSDART00000123103 Essential Splice Site 114 665 3 16
ENSDART00000131955 Essential Splice Site 77 616 3 16
Genomic Location (Zv9):
Chromosome 2 (position 7881031)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8298685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTGACACCAACAAAGATGAGAAGATCAGTTTCGAAGAGTTTGTTGCC[G/A]TAAGCCTGACTATGAGTGTTGTGTTATTGGTCAGAGAATGTCTCAGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057381 Essential Splice Site 165 628 5 17
ENSDART00000123103 Essential Splice Site 202 665 5 16
ENSDART00000131955 Essential Splice Site 153 616 5 16
ENSDART00000057381 Essential Splice Site 165 628 5 17
ENSDART00000123103 Essential Splice Site 202 665 5 16
ENSDART00000131955 Essential Splice Site 153 616 5 16
Genomic Location (Zv9):
Chromosome 2 (position 7874161)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8291815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGACTGACAGTTTATTCAAATCTGTGAAAGATGGAATTTTGCTGTGG[T/C]AATATACCATTAACTGTGGTTTACTCTGGGCTGCTCTCTGTTTGTCATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057381 Essential Splice Site 165 628 5 17
ENSDART00000123103 Essential Splice Site 202 665 5 16
ENSDART00000131955 Essential Splice Site 153 616 5 16
ENSDART00000057381 Essential Splice Site 165 628 5 17
ENSDART00000123103 Essential Splice Site 202 665 5 16
ENSDART00000131955 Essential Splice Site 153 616 5 16
Genomic Location (Zv9):
Chromosome 2 (position 7874161)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8291815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGACTGACAGTTTATTCAAATCTGTGAAAGATGGAATTTTGCTGTGG[T/C]AATATACCATTAACTGTGGTTTACTCTGGGCTGCTCTCTGTTTGTCATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link