si:ch211-12d10.5

Ensembl ID:
ENSDARG00000039266
ZFIN ID:
ZDB-GENE-090312-142
Description:
Novel protein similar to H.sapiens RBM25, RNA binding motif protein 25 (RBM25) [Source:UniProtKB/TrE
Human Orthologues:
AC002365.1, AC003980.1, AC006062.1, AC006999.1, AC007379.1, AC008162.1, AC008573.1, AC008794.1, AC009021.1, AC010133.1, AC011503.2, AC012596.1, AC016595.1, AC022409.1, AC022486.1, AC023481.1, AC067941.1, AC092485.1, AC097714.1, AC116351.3, AL121899.1, AL138690.1, AL159986.1, AL357512.1, AL591242.1, RBM25
Human Description:
RNA binding motif protein 25 [Source:HGNC Symbol;Acc:23244]
Mouse Orthologues:
Gm10563, Rbm25
Mouse Descriptions:
predicted gene 10563 Gene [Source:MGI Symbol;Acc:MGI:3642630]
RNA binding motif protein 25 Gene [Source:MGI Symbol;Acc:MGI:1914289]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19064 Nonsense Mutation detected in F1 DNA During 2017
sa35533 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044784   None 314 None 10
ENSDART00000133677   None 80 None 3
ENSDART00000134140   None 347 None 6
ENSDART00000147165 Nonsense 50 179 4 6

The following transcripts of ENSDARG00000039266 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33243675)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32889623
KASP Assay ID:
2260-6657.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAACTGTGCAATTGTTTTCTCTTTGTTTCTAAACTATGCTAAAGGTTT[T/A]AGTACAAACAGCAGTGCCAGTGGTTCAGAAGCTGAATAGAGACACCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044784 Nonsense 206 314 7 10
ENSDART00000133677   None 80 None 3
ENSDART00000134140   None 347 None 6
ENSDART00000147165   None 179 None 6

The following transcripts of ENSDARG00000039266 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 33226382)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32872330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAGCTGAGGTCACCGGTTCACGGCCTGGAGGAAACACAGAGGAGAAA[C/T]GAAAACACATCAAGAGTCTGATTGAGAAGATTCCTACAGTCAAACAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link