arhgap4a

Ensembl ID:
ENSDARG00000039265
ZFIN ID:
ZDB-GENE-040426-1229
Description:
Rho GTPase activating protein 4 [Source:RefSeq peptide;Acc:NP_956738]
Human Orthologue:
ARHGAP4
Human Description:
Rho GTPase activating protein 4 [Source:HGNC Symbol;Acc:674]
Mouse Orthologue:
Arhgap4
Mouse Description:
Rho GTPase activating protein 4 Gene [Source:MGI Symbol;Acc:MGI:2159577]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1484 Nonsense Available for shipment Available now
sa17901 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Nonsense 195 917 6 24
ENSDART00000145307 Nonsense 195 917 6 24
Genomic Location:
Chromosome 23 (position 25287861)
KASP Assay ID:
554-1409.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAACTGGAGGAAAAGCAAAAACAGAGTGCTTCTAAAAAGATGGAAAGA[C/T]AAATAGAGAAAGTATGTATAGTTTTGCTTTATTAGCAAAATAGGAAATGG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa17901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Essential Splice Site 703 917 19 24
ENSDART00000145307 Essential Splice Site 703 917 19 24
Genomic Location:
Chromosome 23 (position 25299687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGGAGATGGAGAATCAGAGCAGGTTCAAATAAAAGAACCAAAAGAYG[G/A]TAAGSTTGAMATGGTTKACTTATCAGCATTCWGACTARTAGAACTAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eilck48n