LOC797554

Ensembl ID:
ENSDARG00000039238
Human Orthologue:
CACNG4
Human Description:
calcium channel, voltage-dependent, gamma subunit 4 [Source:HGNC Symbol;Acc:1408]
Mouse Orthologue:
Cacng4
Mouse Description:
calcium channel, voltage-dependent, gamma subunit 4 Gene [Source:MGI Symbol;Acc:MGI:1859167]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26737 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057325 Nonsense 234 327 4 4
Genomic Location (Zv9):
Chromosome 6 (position 23200772)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19456218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCACTTTGTGTTTAATAAAACTACCCCTTCCCCCTCATCCTCTATTTA[C/A]ACAACTATCCCAAGCTATCATTACAAACAACAACGGTCCCATTCCTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link