mpll

Ensembl ID:
ENSDARG00000039222
ZFIN ID:
ZDB-GENE-060421-1
Description:
thrombopoietin receptor [Source:RefSeq peptide;Acc:NP_001003858]
Human Orthologue:
MPL
Human Description:
myeloproliferative leukemia virus oncogene [Source:HGNC Symbol;Acc:7217]
Mouse Orthologue:
Mpl
Mouse Description:
myeloproliferative leukemia virus oncogene Gene [Source:MGI Symbol;Acc:MGI:97076]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20736 Nonsense Mutation detected in F1 DNA During 2014
sa881 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa20736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057297 Nonsense 304 655 8 13
ENSDART00000124917 Nonsense 277 614 7 12
Genomic Location:
Chromosome 6 (position 33670542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGTTGTGTCCCAATTGCAATAACTCCATCCATCAGTGTGTCCTGTA[T/A]GGCCAGAAGTCCAATGTCTTTAAGTTTTACCTCAATACAGGGTTGCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa881
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057297 Nonsense 346 655 9 13
ENSDART00000124917 Nonsense 321 614 8 12
Genomic Location:
Chromosome 6 (position 33652540)
KASP Assay ID:
554-0788.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTGTTTTTGACAGTTCAGACAAGGCCTCCAGAAGGTCTGAAGGTA[C/T]AGATTGGGGAAGAAAGGCTTTGTTTGACATGGGATTCACCATTTCTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q86pdfwe