mpll

Ensembl ID:
ENSDARG00000039222
ZFIN ID:
ZDB-GENE-060421-1
Description:
thrombopoietin receptor [Source:RefSeq peptide;Acc:NP_001003858]
Human Orthologue:
MPL
Human Description:
myeloproliferative leukemia virus oncogene [Source:HGNC Symbol;Acc:7217]
Mouse Orthologue:
Mpl
Mouse Description:
myeloproliferative leukemia virus oncogene Gene [Source:MGI Symbol;Acc:MGI:97076]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20736 Nonsense Mutation detected in F1 DNA During 2015
sa881 Nonsense F2 line generated During 2015
sa26776 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa20736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057297 Nonsense 304 655 8 13
ENSDART00000124917 Nonsense 277 614 7 12
Genomic Location:
Chromosome 6 (position 33670542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAAGTTGTGTCCCAATTGCAATAACTCCATCCATCAGTGTGTCCTGTA[T/A]GGCCAGAAGTCCAATGTCTTTAAGTTTTACCTCAATACAGGGTTGCAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa881
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057297 Nonsense 346 655 9 13
ENSDART00000124917 Nonsense 321 614 8 12
Genomic Location:
Chromosome 6 (position 33652540)
KASP Assay ID:
554-0788.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTGTTTTTGACAGTTCAGACAAGGCCTCCAGAAGGTCTGAAGGTA[C/T]AGATTGGGGAAGAAAGGCTTTGTTTGACATGGGATTCACCATTTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057297 Essential Splice Site 436 655 10 13
ENSDART00000124917 Essential Splice Site 411 614 9 12
Genomic Location:
Chromosome 6 (position 33652116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGTGACTGGTCAAAACCTGTTACAACCAACCTACCTTTAAGCAAAGG[T/G]TAACATTCTATTCATAATGTTAAATGTGCCTACTAGATACTTTCTGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q86pdfwe