orc1

Ensembl ID:
ENSDARG00000039217
ZFIN ID:
ZDB-GENE-030131-6960
Description:
origin recognition complex subunit 1 [Source:RefSeq peptide;Acc:NP_956227]
Human Orthologue:
ORC1
Human Description:
origin recognition complex, subunit 1 [Source:HGNC Symbol;Acc:8487]
Mouse Orthologue:
Orc1
Mouse Description:
origin recognition complex, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1328337]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20735 Nonsense Available for shipment Available now
sa40726 Nonsense Mutation detected in F1 DNA During 2016
sa38557 Nonsense Mutation detected in F1 DNA During 2016
sa13649 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20735
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057293 Nonsense 178 912 5 19
ENSDART00000130492 Nonsense 178 912 5 19

The following transcripts of ENSDARG00000039217 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33634941)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33952606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTTCCAAGCGGTGGATCCTGAGCTGATAGAACCTCCTCCCAGCCCT[A/T]AATCTCCCCCGCCATCTTCACGGGGCCCTCAGGCTCGTCCTCTTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40726
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057293 Nonsense 267 912 6 19
ENSDART00000130492 Nonsense 267 912 6 19

The following transcripts of ENSDARG00000039217 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33635298)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33952963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTCTCTGATTTATTTTCATTGTGTTAGGTCCAAGCAAAAACATGTCC[C/T]GAGATGATGTTCTGGGGGAGATTTTAGATAAACACATCGATACAGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057293 Nonsense 330 912 6 19
ENSDART00000130492 Nonsense 330 912 6 19

The following transcripts of ENSDARG00000039217 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33635489)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33953154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGCCTCTGTCATCACACAGCCCTGATAAACCCACACTGACTGCATA[T/A]GGAAGTGACAGTGCGACCAGGTACATCTTTTTGCATCTGATATTTTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13649
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057293 Nonsense 895 912 19 19
ENSDART00000130492 Nonsense 895 912 19 19

The following transcripts of ENSDARG00000039217 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33645070)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33962735
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCWCCTGTCGCTTGCTGCTGCTTGAAGGAAGCCGTCTGGACCTGTTTCTC[C/T]GAATCCGTCTCAATGTTAGTCAAGAYGATGTGCTTTATGCCTTGAAGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link