nasp

Ensembl ID:
ENSDARG00000039208
ZFIN ID:
ZDB-GENE-030131-5511
Description:
nuclear autoantigenic sperm protein [Source:RefSeq peptide;Acc:NP_956076]
Human Orthologue:
NASP
Human Description:
nuclear autoantigenic sperm protein (histone-binding) [Source:HGNC Symbol;Acc:7644]
Mouse Orthologue:
Nasp
Mouse Description:
nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI Symbol;Acc:MGI:1355328]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26775 Missense Mutation detected in F1 DNA During 2017
sa17620 Nonsense Available for shipment Available now
sa17988 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa26775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031108 Missense 173 622 6 15
ENSDART00000057285 Missense 173 407 6 14
ENSDART00000137447   None 343 None 11
ENSDART00000138488 Missense 173 622 6 15
ENSDART00000141483 Missense 173 470 6 15
ENSDART00000146373   None 188 None 6

The following transcripts of ENSDARG00000039208 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33611899)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33929564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGAAGGCGAACGGAACAACAAAGAGGAAGATGAGAAGCAGGTAAAGG[T/A]AGATGAAGCACCAAAGGAAGCAGATACTGCATCTAAAACTGAGAAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031108 Nonsense 293 622 6 15
ENSDART00000057285 Nonsense 293 407 6 14
ENSDART00000137447   None 343 None 11
ENSDART00000138488 Nonsense 293 622 6 15
ENSDART00000141483 Nonsense 293 470 6 15
ENSDART00000146373   None 188 None 6

The following transcripts of ENSDARG00000039208 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33611540)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33929205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATGAAGATGAGAAATCCAAGGGTGAGGATGAAGACKCTTCTACAAAT[A/T]AAGATGTCACTGTGTCAAACGGAATTGCTRAAAAGAATAAAGATGAAAGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17988
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031108 Nonsense 590 622 14 15
ENSDART00000057285   None 407 13 14
ENSDART00000137447   None 343 None 11
ENSDART00000138488 Nonsense 590 622 14 15
ENSDART00000141483   None 470 14 15
ENSDART00000146373   None 188 None 6

The following transcripts of ENSDARG00000039208 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 33609468)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 33927133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGAGTCCAAAAAAGGACAGTGATGCTAAAAAGACTAAACAGGACACCT[C/A]AGTTAATGGCAGCGACGACTCCGCCCACAACGGCAATGGAGTCCAGGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link